Vector Database
Welcome to Vector Database!
Vector database is a digital-only collection of vector backbone information compiled by Addgene from third party sources.
This vector is NOT available from Addgene and the database is no longer actively maintained.
Plasmid: pQUAST
Information
- Source/Vendor
- Christopher Potter/Liqun Luo
- Plasmid Type
- Other, expression
- Promoter
- hsp70 minimal promoter
- Cloning Method
- Unknown
- Size
- 8950
- 5' Sequencing 1 Primer
- pCasper-hs
- 5' Sequencing 1 Primer Sequence
- GCAACTACTGAAATCTGCCAAG
- Bacterial Resistance
- Ampicillin
- Catalog Number
- Addgene plasmid 24349
- Stable
- Unspecified
- Constitutive
- Unspecified
- Viral/Non-Viral
- Unspecified