Vector Database
Welcome to Vector Database!
Vector database is a digital-only collection of vector backbone information compiled by Addgene from third party sources.
This vector is NOT available from Addgene and the database is no longer actively maintained.
Plasmid: pSIH1-H1-copGFP
Information
- Source/Vendor
- System Biosciences
- Plasmid Type
- Mammalian Expression
- Promoter
- H1
- Cloning Method
- Unknown
- 5' Sequencing 1 Primer
- H1
- 5' Sequencing 1 Primer Sequence
- tcgctatgtgttctgggaaa
- Bacterial Resistance
- Ampicillin
- Stable
- Unspecified
- Constitutive
- Unspecified
- Viral/Non-Viral
- Lentiviral