Vector Database
Welcome to Vector Database!
Vector database is a digital-only collection of vector backbone information compiled by Addgene from third party sources.
This vector is NOT available from Addgene and the database is no longer actively maintained.
Plasmid: pSIREN-RetroQ-ZsGreen
Information
- Source/Vendor
- Clontech
- Plasmid Type
- Mammalian Expression
- Promoter
- PU6
- Cloning Method
- Unknown
- Size
- 6600
- 5' Sequencing 1 Primer
- U6
- 5' Sequencing 1 Primer Sequence
- 5'd[ATGGACTATCATATGCTTACCGTA]3'
- Bacterial Resistance
- Ampicillin
- Notes
- For retroviral siRNA expression. Use Green Fluorescence to monitor expression.
- Catalog Number
- 632455
- Stable
- Stable
- Constitutive
- Constitutive
- Viral/Non-Viral
- Retroviral