Vector Database
Welcome to Vector Database!
Vector database is a digital-only collection of vector backbone information compiled by Addgene from third party sources.
This vector is NOT available from Addgene and the database is no longer actively maintained.
This vector is not available from Addgene.
Plasmid: pSV2-dhfr
Information
- Source/Vendor
- ATCC
- Plasmid Type
- Unspecified
- Cloning Method
- Unknown
- Size
- 5000
- 5' Sequencing 1 Primer
- SV40pro-F
- 5' Sequencing 1 Primer Sequence
- TATTTATGCAGAGGCCGAGG
- Notes
- A mammalian cell/E.coli shuttle vector. Confers selective advantage to mammalian cell lines grown in the presence of methotrexate. Selectable marker in dhfr- cell culture strains. (ATCC staff) Restriction digests analyzed on agarose gels give the following sizes (kb): BamHI--5.2; PvuII/HindIII--4.8, 0.3; BglII/EcoRI--3.6, 1.5; AccI/HindIII--3.6, 0.54, 0.44, 0.27; AccI--3.6, 0.96, 0.27; HindIII--5.0; PstI--4.1, 0.9. (ATCC staff) Restriction digests of the clone give the following sizes (kb): EcoRI--4.8; HindIII--4.8; BamHI--4.8. (ATCC staff) Medium is 1227 LB plus ampicillin. Hosts: E.coli HB101, E.coli MC1061, vertebrate cells, E.coli. (Information source: <a href=http://seq.yeastgenome.org/vectordb target=_blank>VectorDB</a>.)
- Catalog Number
- 67110
- Stable
- Unspecified
- Constitutive
- Unspecified
- Viral/Non-Viral
- Unspecified