Vector Database
Welcome to Vector Database!
Vector database is a digital-only collection of vector backbone information compiled by Addgene from third party sources.
This vector is NOT available from Addgene and the database is no longer actively maintained.
This vector is not available from Addgene.
Plasmid: pSV2neo
Information
- Source/Vendor
- ATCC
- Alt Name
- pSV2 neo
- Plasmid Type
- Mammalian Expression
- Cloning Method
- Unknown
- Size
- 5729
- 5' Sequencing 1 Primer
- SV40pro-F
- 5' Sequencing 1 Primer Sequence
- TATTTATGCAGAGGCCGAGG
- Bacterial Resistance
- Ampicillin
- Selectable Marker
- Neomycin
- Notes
- ATCC size is 5600 bp. Provides dominant selectable marker for resistance to antibiotic G418 in mammalian cell lines. (ATCC staff) Restriction digests of the clone give the following sizes (kb): PvuII--4.2, 0.74, 0.61, 0.36; BamHI--5.8; EcoRI--5.8; PstI--2.45, 1.40, 0.94 (doublet). (ATCC staff) Medium is 1227 LB plus ampicillin. Hosts: E.coli HB101, E.coli, human fibroblast or lymphoblast cells, vertebrate cells. Related vectors: pBR322, SV40, Tn5. (Information source: <a href=http://seq.yeastgenome.org/vectordb target=_blank>VectorDB</a>.)
- Catalog Number
- 37149
- Stable
- Unspecified
- Constitutive
- Unspecified
- Viral/Non-Viral
- Unspecified