Vector Database
Welcome to Vector Database!
Vector database is a digital-only collection of vector backbone information compiled by Addgene from third party sources.
This vector is NOT available from Addgene and the database is no longer actively maintained.
Plasmid: pTRE-myc
Information
- Source/Vendor
- Clontech
- Plasmid Type
- Mammalian Expression
- Induced by
- Tetracycline
- Promoter
- Tet-responsive
- Cloning Method
- Unknown
- Size
- 3800
- 5' Sequencing 1 Primer
- Myc
- 5' Sequencing 1 Primer Sequence
- 5'd[GCATCAATGCAGAAGCTGATCTCA]3'
- Tag 1
- Myc
- Bacterial Resistance
- Ampicillin
- Notes
- Myc tag gene under tet-responsive promoter
- Catalog Number
- 631010
- Stable
- Transient
- Constitutive
- Inducible
- Viral/Non-Viral
- Nonviral