Vector Database
Welcome to Vector Database!
Vector database is a digital-only collection of vector backbone information compiled by Addgene from third party sources.
This vector is NOT available from Addgene and the database is no longer actively maintained.
Plasmid: pTTQ18
Information
- Source/Vendor
- Michael Stark
- Plasmid Type
- Bacterial Expression
- Promoter
- Tac promoter
- Expression Level
- High
- Cloning Method
- Unknown
- Size
- 4563
- 5' Sequencing 1 Primer
- Tac promoter
- 5' Sequencing 1 Primer Sequence
- GAGCGGATAACAATTTCACACAGG
- Bacterial Resistance
- Ampicillin
- Stable
- Unspecified
- Constitutive
- Unspecified
- Viral/Non-Viral
- Nonviral
Sequence
Published Plasmid Map
