Vector Database
Welcome to Vector Database!
Vector database is a digital-only collection of vector backbone information compiled by Addgene from third party sources.
This vector is NOT available from Addgene and the database is no longer actively maintained.
Plasmid: pYES-DEST52
Information
- Source/Vendor
- Invitrogen
- Plasmid Type
- Yeast Expression, Saccharomyces cerevisiae
- Induced by
- Galactose
- Promoter
- P-GAL1
- Cloning Method
- Unknown
- Size
- 7600
- 5' Sequencing 1 Primer
- GAL1
- 5' Sequencing 1 Primer Sequence
- 5'd[AATATACCTCTATACTTTAACGTC]3'
- Tag 1
- V5 (Cterm), His (Cterm)
- Bacterial Resistance
- Ampicillin
- Selectable Marker
- URA3
- Notes
- Gateway destination vector
- Catalog Number
- 12286019
- Stable
- Unspecified
- Constitutive
- Inducible
- Viral/Non-Viral
- Nonviral