Vector Database
Welcome to Vector Database!
Vector database is a digital-only collection of vector backbone information compiled by Addgene from third party sources.
This vector is NOT available from Addgene and the database is no longer actively maintained.
Plasmid: pCMV6-XL5
Information
- Source/Vendor
- Origene
- Plasmid Type
- Mammalian Expression
- Promoter
- CMV
- Expression Level
- High
- Cloning Method
- Restriction Enzyme
- Size
- 4707
- 5' Sequencing 1 Primer
- pCMV6 forward
- 5' Sequencing 1 Primer Sequence
- GGACTTTCCAAAATGTCG
- 3' Sequencing 1 Primer
- T7
- 5' Sequencing 2 Primer
- pCMV6 reverse
- 5' Sequencing 2 Primer Sequence
- TAATCCTGTTCCGACCACCC
- 5' Terminal
- N-Term
- 5' Terminal 2
- C-Term
- 3' Terminal
- N-Term
- Stable
- Transient
- Constitutive
- Constitutive
- Viral/Non-Viral
- Nonviral
Sequence
Published Plasmid Map
