Vector Database
Welcome to Vector Database!
Vector database is a digital-only collection of vector backbone information compiled by Addgene from third party sources.
This vector is NOT available from Addgene and the database is no longer actively maintained.
Plasmid: pUASp
Information
- Alt Name
- pUASp
- Plasmid Type
- Insect Expression, Fly Transformation
- Promoter
- UAS Gal4
- Expression Level
- Unknown
- Cloning Method
- Unknown
- Size
- 9939
- 5' Sequencing 1 Primer
- pUASp-5
- 5' Sequencing 1 Primer Sequence
- GGCAAGGGTCGAGTCGATAG
- 3' Sequencing 1 Primer
- pUASp-3
- 3' Sequencing 1 Primer Sequence
- AGGTTTAACCAGGGGATGCT
- Bacterial Resistance
- Ampicilin
- GenBank
- AY831681
- Stable
- Unspecified
- Constitutive
- Unspecified
- Viral/Non-Viral
- Nonviral