Vector Database
Welcome to Vector Database!
Vector database is a digital collection of vector backbones assembled from publications and commercially available sources. This is a free resource for the scientific community that is compiled by Addgene.
This page is informational only - this vector is NOT available from Addgene - please contact the manufacturer for further details.
This vector is NOT available from Addgene.
Plasmid: pEXT20
| Alt Name: | pEXT20 |
| Analyze: | Sequence |
| Expression Level: | Unknown |
| Cloning Method: | Restriction Enzyme |
| Size: | 3913 |
| 5' Sequencing 1 Primer: | rrnB-T2-term-R |
| 5' Sequencing 1 Primer Sequence: | aaaggccatccgtcaggat |
| 3' Sequencing 1 Primer: | M13pUC-rev |
| 3' Sequencing 1 Primer Sequence: | AGCGGATAACAATTTCACACAGG |
| 5' Terminal: | N-Term |
| 3' Terminal: | C-Term |
| Stable: | Unspecified |
| Constitutive: | Inducible |
| Viral/Non-Viral: | Nonviral |