Vector Database
Welcome to Vector Database!
Vector database is a digital-only collection of vector backbone information compiled by Addgene from third party sources.
This vector is NOT available from Addgene and the database is no longer actively maintained.
This vector is not available from Addgene.
Plasmid: pUASp-FMW
Information
- Alt Name
- pPFMW
- Plasmid Type
- Fly cloning and transformation
- Promoter
- UASp
- Expression Level
- Unknown
- Cloning Method
- Gateway Cloning
- Size
- 12028
- 5' Sequencing 1 Primer
- pUASp-5
- 5' Sequencing 1 Primer Sequence
- GGCAAGGGTCGAGTCGATAG
- 3' Sequencing 1 Primer
- pUASp-3
- 3' Sequencing 1 Primer Sequence
- AGGTTTAACCAGGGGATGCT
- Tag 1
- 3xFLAG-6xMyc
- Notes
- N-terminal 3xFLAG and 6xMyc tags
- Stable
- Unspecified
- Constitutive
- Unspecified
- Viral/Non-Viral
- Nonviral