Vector Database
Welcome to Vector Database!
Vector database is a digital-only collection of vector backbone information compiled by Addgene from third party sources.
This vector is NOT available from Addgene and the database is no longer actively maintained.
Plasmid: pAFMW
Information
- Source/Vendor
- Murhpy Lab, Carnegie Institution for Science
- Plasmid Type
- Drosophila Gateway™ Vector
- Promoter
- Actin5C
- Expression Level
- Unknown
- Cloning Method
- Gateway Cloning
- Size
- 7585
- 5' Sequencing 1 Primer
- AC5
- 5' Sequencing 1 Primer Sequence
- ACACAAAGCCGCTCCATCAG
- 3' Sequencing 1 Primer
- SV40pA-R
- 3' Sequencing 1 Primer Sequence
- GAAATTTGTGATGCTATTGC
- 5' Terminal
- N-Term
- 3' Terminal
- C-Term
- Tag 1
- 3xFLAG-6xMyc
- Stable
- Unspecified
- Constitutive
- Unspecified
- Viral/Non-Viral
- Nonviral