Vector Database
Welcome to Vector Database!
Vector database is a digital-only collection of vector backbone information compiled by Addgene from third party sources.
This vector is NOT available from Addgene and the database is no longer actively maintained.
This vector is not available from Addgene.
Plasmid: pAFMW
Information
- Source/Vendor
- Murhpy Lab, Carnegie Institution for Science
- Plasmid Type
- Drosophila Gateway™ Vector
- Promoter
- Actin5C
- Expression Level
- Unknown
- Cloning Method
- Gateway Cloning
- Size
- 7585
- 5' Sequencing 1 Primer
- AC5
- 5' Sequencing 1 Primer Sequence
- ACACAAAGCCGCTCCATCAG
- 3' Sequencing 1 Primer
- SV40pA-R
- 3' Sequencing 1 Primer Sequence
- GAAATTTGTGATGCTATTGC
- 5' Terminal
- N-Term
- 3' Terminal
- C-Term
- Tag 1
- 3xFLAG-6xMyc
- Stable
- Unspecified
- Constitutive
- Unspecified
- Viral/Non-Viral
- Nonviral