Vector Database
Welcome to Vector Database!
Vector database is a digital-only collection of vector backbone information compiled by Addgene from third party sources.
This vector is NOT available from Addgene and the database is no longer actively maintained.
Plasmid: pLEXm
Information
- Source/Vendor
- Jones lab University of Oxford
- Promoter
- Chicken beta-actin
- Expression Level
- High
- Cloning Method
- Restriction Enzyme
- Size
- 4529
- 5' Sequencing 1 Primer
- Bglob-intron-F
- 5' Sequencing 1 Primer Sequence
- ctggtcatcatcctgccttt
- 3' Sequencing 1 Primer
- Bglob-pA-R
- 3' Sequencing 1 Primer Sequence
- ttttggcagagggaaaaaga
- Notes
- PMID: 17001101
- Stable
- Transient
- Constitutive
- Unspecified
- Viral/Non-Viral
- Nonviral
Published Plasmid Map