Vector Database
Welcome to Vector Database!
Vector database is a digital-only collection of vector backbone information compiled by Addgene from third party sources.
This vector is NOT available from Addgene and the database is no longer actively maintained.
This vector is not available from Addgene.
Plasmid: pGZ21dxZ
Information
- Alt Name
- pGZ21 dxZ
- Promoter
- CMV
- Expression Level
- Unknown
- Cloning Method
- Restriction Enzyme
- 5' Sequencing 1 Primer
- GFP FW primer
- 5' Sequencing 1 Primer Sequence
- AAAGACCCCAACGAGAAGCG
- 3' Sequencing 1 Primer
- GFP ASO primer
- 3' Sequencing 1 Primer Sequence
- TTGTAACCATTATAAGCTGC
- 5' Terminal
- N-Term
- Tag 1
- GFP
- Bacterial Resistance
- Ampicillin
- Notes
- MCS contains BamHI, HindIII, EcoRI, XbaI, SalI, PstI, and NheI. Created by Kenneth Yamada at NIDCR.
- Stable
- Unspecified
- Constitutive
- Constitutive
- Viral/Non-Viral
- Nonviral