Vector Database
Welcome to Vector Database!
Vector database is a digital-only collection of vector backbone information compiled by Addgene from third party sources.
This vector is NOT available from Addgene and the database is no longer actively maintained.
This vector is not available from Addgene.
Plasmid: pMirTarget
Information
- Alt Name
- pMir-Target
- Plasmid Type
- Luciferase
- Expression Level
- Unknown
- Cloning Method
- Restriction Enzyme
- Size
- 7868
- 5' Sequencing 1 Primer
- Fluc-F1
- 5' Sequencing 1 Primer Sequence
- AGAAGCTGCGCGGTGGTGTTGTG
- 3' Sequencing 1 Primer
- TK-pA-R
- 3' Sequencing 1 Primer Sequence
- ttgtctccttccgtgtttca
- Bacterial Resistance
- Kanamycin
- Selectable Marker
- Neomycin
- Stable
- Unspecified
- Constitutive
- Unspecified
- Viral/Non-Viral
- Unspecified