Vector Database
Welcome to Vector Database!
Vector database is a digital-only collection of vector backbone information compiled by Addgene from third party sources.
This vector is NOT available from Addgene and the database is no longer actively maintained.
This vector is not available from Addgene.
Plasmid: pUWR
Information
- Source/Vendor
- Constructed by Clara Moch in Dr. Jean-Rene Huynh's Laboratory
- Plasmid Type
- Insect Expression
- Expression Level
- Unknown
- Cloning Method
- Gateway Cloning
- Size
- 12396
- Bacterial Resistance
- Ampicillin
- Notes
- Plasmid based on pCaSpeR4-pUbi vector Features: Poly-Ubiquitin promoter : 1-1711 W = Gateway cassette (Invitrogen) : 1744-3456 attR1 : 1748-1765 ChlR : 1981-2662 ccdB : 2982-3287 attR2 : 3435-3452 mRFP : 3460-4134 Triple stop : 4143-4155 Hsp27 terminator : 4279-4642 P element 3' end (complement) : 4657-4889 AmpR : 5796-6656 P element 5' end : 7650-8236 Mini-white gene (complement) : 9013-11896 Recommended sequencing primers after Gateway recombination : Pubi-F : CCAGCCAGGAAGTTAGTT to verify promoter-gene junction RFP-R : GGACAGCTTCAAGTAGTCGG to verify gene-RFP junction
- Stable
- Unspecified
- Constitutive
- Unspecified
- Viral/Non-Viral
- Nonviral