This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

PCS2+Cas9-mSA
(Plasmid #103882)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 103882 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    PCS2+
  • Backbone size w/o insert (bp) 4072
  • Total vector size (bp) 8886
  • Modifications to backbone
    none
  • Vector type
    CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    none
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CAS9-MSA
  • Species
    synthetic
  • Insert Size (bp)
    4818
  • Mutation
    none
  • Promoter SP6
  • Tag / Fusion Protein
    • MSA (monomeric streptavidin (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Kpn1 (not destroyed)
  • 3′ cloning site destroyed (unknown if destroyed)
  • 5′ sequencing primer ATTTAGGTGACACTAT
  • 3′ sequencing primer CCTGTGTGAAATTGTTATCC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    We cloned this gene ourselves. But we used Cas9 sequence from px330 plasmid from add gene and the MSA sequence from pDisplay-mSA-EGFP-TM (Plasmid #39863)
  • Terms and Licenses

Depositor Comments

non

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    PCS2+Cas9-mSA was a gift from Janet Rossant (Addgene plasmid # 103882 ; http://n2t.net/addgene:103882 ; RRID:Addgene_103882)
  • For your References section:

    Efficient generation of targeted large insertions by microinjection into two-cell-stage mouse embryos. Gu B, Posfai E, Rossant J. Nat Biotechnol. 2018 Jun 11. pii: nbt.4166. doi: 10.1038/nbt.4166. 10.1038/nbt.4166 PubMed 29889212