PBS Actb-2A-TIR1-GFP
(Plasmid
#113832)
-
Purposetargeting osTIR1-GFP into mouse Actb locus for auxin inducible degradation
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | ||
---|---|---|---|---|---|---|
Plasmid | 113832 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepbluescript
-
Vector typeSynthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameosTIR1-GFP
-
SpeciesSynthetic
-
Entrez GeneNEWENTRY
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CACACAGGAAACAGCTATGAC
- 3′ sequencing primer CGCAACTGTTGGGAAGGGC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Terms and Licenses
-
Industry Terms
- Not Available to Industry
Depositor Comments
This vector is good for targeting experiment in early embryos and mouse cell lines. Viability problem have been observed when generating knock-in mice.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PBS Actb-2A-TIR1-GFP was a gift from Janet Rossant (Addgene plasmid # 113832 ; http://n2t.net/addgene:113832 ; RRID:Addgene_113832) -
For your References section:
Efficient generation of targeted large insertions by microinjection into two-cell-stage mouse embryos. Gu B, Posfai E, Rossant J. Nat Biotechnol. 2018 Jun 11. pii: nbt.4166. doi: 10.1038/nbt.4166. 10.1038/nbt.4166 PubMed 29889212