1
Plasmid 10825: pIRESneo-FLAG/HA EGFP
  • EGFP

  • 726

  • Aequorea victoria

  • FLAG

  • N terminal on insert

  • HA

  • N terminal on insert

  • pIRESneo
    (Search Vector Database)

  • Clontech

  • Mammalian Expression

  • 5328

  • BamHI

  • No

  • EcoRI

  • No

  • ggtaccgagctcggatcgat List of Sequencing Primers

  • agctgttggggtgagtactcc

  • Ampicillin

  • DH5alpha

  • 37

  • High Copy

  • Neomycin

  • View sequences (2)
  • Thomas Tuschl

  • MTA

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: Human Argonaute2 mediates RNA cleavage targeted by miRNAs and siRNAs. Meister et al (Mol Cell. 2004 Jul 23. 15(2):185-97. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 10825" in your Materials and Methods section.