Modified Shipping Schedule: Addgene will be closed November 23rd & 24th for the Thanksgiving holiday. Order processing and shipping may be delayed the week of Nov 20 - 24. If you have any questions, please contact us at [email protected].
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

LL - hNANOGi
(Plasmid #12196)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 12196 Plasmid sent as bacteria in agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pLL3.7
  • Backbone size w/o insert (bp) 7650
  • Vector type
    Mammalian Expression, Lentiviral, RNAi, Cre/Lox

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    NANOG - RNAi
  • Alt name
    Nanog
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    55
  • Entrez Gene
    NANOG

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HpaI (destroyed during cloning)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer n/a
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

Target sequence: GGGTTAAGCTGTAACATACTT
(NM_024865: bp 1857-1877)

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    LL - hNANOGi was a gift from George Daley (Addgene plasmid # 12196)
  • For your References section:

    High-efficiency RNA interference in human embryonic stem cells. Zaehres H, Lensch MW, Daheron L, Stewart SA, Itskovitz-Eldor J, Daley GQ. Stem Cells. 2005 Mar . 23(3):299-305. 10.1634/stemcells.2004-0252 PubMed 15749924