This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

LL - hOCT4i -2
(Plasmid #12197)


Item Catalog # Description Quantity Price (USD)
Plasmid 12197 Plasmid sent as bacteria in agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 7650
  • Vector type
    Mammalian Expression, Lentiviral, RNAi, Cre/Lox

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
    OCT4 - RNAi
  • Alt name
  • Species
    H. sapiens (human)
  • Insert Size (bp)
  • Entrez Gene
    POU5F1 (a.k.a. OCT3, OCT4, OTF-3, OTF3, OTF4, Oct-3, Oct-4)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HpaI (destroyed during cloning)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer mU6-F
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

Target sequence: GGATGTGGTCCGAGTGTGGTT (NM_002701: bp 867-887)

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    LL - hOCT4i -2 was a gift from George Daley (Addgene plasmid # 12197)
  • For your References section:

    High-efficiency RNA interference in human embryonic stem cells. Zaehres H, Lensch MW, Daheron L, Stewart SA, Itskovitz-Eldor J, Daley GQ. Stem Cells. 2005 Mar . 23(3):299-305. 10.1634/stemcells.2004-0252 PubMed 15749924