1
Plasmid Cart
Login to add to cart
Recently Visited
Plasmid 13670: pQLinkN
  • multi cloning site

  • pQToT

  • 29

  • pQE-2
    (Search Vector Database)

  • Bacterial Expression

  • Co-expression

  • 4794

  • BamHI

  • No

  • NotI

  • No

  • pQE65, TGAGCGGATAACAATTTCACACAG List of Sequencing Primers

  • pQE276, GGCAACCGAGCGTTCTGAAC

  • Ampicillin

  • DH5alpha

  • 37

  • Unknown

  • View sequences (2)
  • Konrad Buessow

  • MTA

Comments: 

Please note that the chloramphenicol resistance gene in this plasmid is incomplete. It is lacking a promoter, therefore it is supposed to be inactive.

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: Vectors for co-expression of an unrestricted number of proteins. Scheich et al (Nucleic Acids Res. 2007 Feb 20. ():. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 13670" in your Materials and Methods section.