-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 13673 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepQE-2
-
Backbone manufacturerQiagen
- Backbone size w/o insert (bp) 5356
-
Vector typeBacterial Expression ; Co-Expression
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol and Ampicillin, 25 & 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DB3.1
-
Growth instructionsDB3.1 from Invitrogen
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameGateway cassette
-
Alt namepDESTcoG
-
Insert Size (bp)2342
-
GenBank IDEF025687
-
Tag
/ Fusion Protein
- GST (N terminal on backbone)
Cloning Information
- Cloning method Gateway Cloning
- 5′ cloning site attR1 (destroyed during cloning)
- 3′ cloning site attR2 (destroyed during cloning)
- 5′ sequencing primer pGEX5'
- 3′ sequencing primer pQE276, GGCAACCGAGCGTTCTGAAC (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note that the chloramphenicol resistance gene outside the attB sites in this plasmid is incomplete. It is lacking a promoter, therefore it is supposed to be inactive.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pQLinkGD was a gift from Konrad Buessow (Addgene plasmid # 13673 ; http://n2t.net/addgene:13673 ; RRID:Addgene_13673) -
For your References section:
Vectors for co-expression of an unrestricted number of proteins. Scheich C, Kummel D, Soumailakakis D, Heinemann U, Bussow K. Nucleic Acids Res. 2007 Feb 20. ():. 10.1093/nar/gkm067 PubMed 17311810