-
PurposeLentiviral expression of Halo-GFP for neuronal inhibition
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 14750 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneFCK(1.3)GW
-
Backbone manufacturerPavel Osten
- Backbone size w/o insert (bp) 9500
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Growth instructionsUse recombinase-free E. coli (e.g., Invitrogen's Stbl3)
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameMammalian codon-optimized halorhodopsin, from Natronomas pharaonis (N. pharaonis), fused with GFP at the C-terminus
-
Alt nameHalo
-
Alt nameHalo-GFP
-
Alt nameNpHR
-
SpeciesN. pharaonis
-
Insert Size (bp)1300
-
MutationN. pharaonis halorhodopsin is mammalian codon-optimized
- Promoter CaMKIIa
-
Tag
/ Fusion Protein
- GFP (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer atgactgagaccctcccacccgtgactgaaagcgccgt (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byWe purchased the gene to be synthesized by Epoch Biolabs (Sugar Land, TX)
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
PLEASE CONTACT ED BOYDEN ([email protected]) FOR DETAILS ON THIS
REAGENT AND FURTHER REAGENTS IN THIS LINE.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
FCK-Halo-GFP was a gift from Edward Boyden (Addgene plasmid # 14750 ; http://n2t.net/addgene:14750 ; RRID:Addgene_14750) -
For your References section:
Multiple-color optical activation, silencing, and desynchronization of neural activity, with single-spike temporal resolution. Han X, Boyden ES. PLoS One. 2007 Mar 21;2(3):e299. 10.1371/journal.pone.0000299 PubMed 17375185