|
Home
Deposit Plasmids
Request Plasmids
Plasmid Tools
About Addgene
Browse > Edward Boyden > Han et al > FCK-Halo-GFP

 

Plasmid Links
Author's map
Sequence
Related Plasmids
From this article
Edward Boyden Lab Plasmids
 

This is commonly
requested with
FCK-ChR2-GFP
pCAGGS-ChR2- Venus
Print Friendly    Email
Plasmid 14750: FCK-Halo-GFP
Gene/insert name: Mammalian codon-optimized halorhodopsin, from Natronomas pharaonis (N. pharaonis), fused with GFP at the C-terminus
Alternative names: Halo
Halo-GFP
NPhR
Insert size (bp): 1300
Species of gene(s): N. pharaonis
Relevant mutations/deletions: N. pharaonis halorhodopsin is mammalian codon-optimized
Fusion proteins or tags: GFP
Terminal: C terminal on insert
Vector backbone: FCK(1.3)GW  (Search Vectorpedia)
Backbone manufacturer: Pavel Osten
Type of vector: Mammalian expression,Bacterial expression,Lentiviral
Backbone size (bp): 9500
Cloning site 5': AgeI
Site destroyed during cloning: No
Cloning site 3': EcoRI
Site destroyed during cloning: No
5' Sequencing primer: atgactgagaccctcccacccgtg actgaaagcgccgt  (List of Sequencing Primers)
Bacteria resistance: Ampicillin
High or low copy: Don't Know
Grow in standard E. coli @ 37C: No
Please specify bacterial strain for growth and growth condition: Use recombinase-free E. coli (e.g., Invitrogen's Stbl3)
If you did not originally clone this gene, from whom and where did you receive the plasmid used to derive this plasmid: We purchased the gene to be synthesized by Epoch Biolabs (Sugar Land, TX)
Sequence:View sequence
Author's Map:View map
Plasmid Provided In:Stbl3
Principal Investigator:Edward Boyden
Terms and Licenses:MTA

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Click on map to enlarge

Selected features
CAG_enhancer 318 - 605
CMV_immearly_promoter 239 - 815
CMV_fwd_primer 772 - 792
HIV-1_5_LTR 835 - 1015
truncHIV-1_3_LTR 835 - 1015
HIV-1_psi_pack 1126 - 1170
RRE 1680 - 1913
Orf frame 1 1558 - 2445
cPPT 2444 - 2459
Orf frame 1 4425 - 3703
Orf frame 1 3745 - 5514
EGFP_N_primer 4861 - 4840
EGFP 4795 - 5511
EGFP_C_primer 5448 - 5469
WPRE 5557 - 6144
Orf frame 3 5658 - 6695
cPPT 6332 - 6347
U3PPT 6332 - 6353
HIV-1_5_LTR 6669 - 6849
truncHIV-1_3_LTR 6669 - 6849
BGH_rev_primer 6892 - 6875
bGH_PA_terminator 6878 - 7105
f1_origin 7168 - 7474
pBABE_3_primer 7608 - 7588
SV40_enhancer 7809 - 7594
SV40_promoter 7606 - 7874
SV40_origin 7773 - 7850
SV40pro_F_primer 7835 - 7854
EM7_promoter 7968 - 8035
bleo 8036 - 8407
sh_ble 8036 - 8410
SV40_PA_terminator 8543 - 8662
EBV_rev_primer 8631 - 8650
M13_reverse_primer 8724 - 8706
M13_pUC_rev_primer 8745 - 8723
lac_promoter 8788 - 8759
pBR322_origin 9716 - 9097
Orf frame 1 10731 - 9871
Ampicillin 10731 - 9871
AmpR_promoter 10801 - 10773
Unique restriction sites

SpeI 252
NdeI 487
NarI 1019
BamHI 3895
AgeI 4782
EcoRI 5531
SacII 6058
XhoI 6160
KpnI 6282
FspI 10166

Article: Multiple-color optical activation, silencing, and desynchronization of neural activity, with single-spike temporal resolution. Han X et al. (PLoS ONE. 2007 . 2():e299. Pubmed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication.

Also, please include the text "Addgene plasmid 14750" in your Materials and Methods section. This information allows Addgene to create a link from the plasmid page to your publication.

Home | Contact | Terms of Use | MTA and Licenses | Privacy Policy | Site Map © 2003-2007 Addgene, Inc. All Rights Reserved
Plasmid Cart
Your cart is empty.