Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at Learn more

pKP332 (Lenti-OSK1)
(Plasmid #21627)

Add to Cart
Available to Academic and Nonprofits Only


  • Vector backbone
    pDL171 (pWPI with deletion of 1409 bp XhoI [EMCV IRES GFP] frag)
  • Backbone size w/o insert (bp) 9692
  • Vector type
    Mammalian Expression, Lentiviral, Cre/Lox

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy

Sequence Information


  • Gene/Insert name
    hOCT4 - 2A - hSOX2 - 2A - hKLF4
  • Alt name
  • Alt name
    Porcine teschovirus-1 2A peptide
  • Species
    H. sapiens (human); Porcine teschovirus-1
  • Insert Size (bp)
  • GenBank ID
    BC117435 BC029923 BC013923
  • Entrez Gene
    POU5F1 (a.k.a. OCT3, OCT4, OTF-3, OTF3, OTF4, Oct-3, Oct-4)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SwaI (not destroyed)
  • 3′ cloning site SwaI (not destroyed)
  • 5′ sequencing primer GGCACCTCGATTAGTTCTCGAGC
  • 3′ sequencing primer AATCCAGAGGTTGATTATCG
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

Plasmid constructed by Kevin Pawlik

How to cite this plasmid

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pKP332 (Lenti-OSK1) was a gift from Tim Townes (Addgene plasmid # 21627)
  • For your References section:

    Polycistronic lentiviral vector for "hit and run" reprogramming of adult skin fibroblasts to induced pluripotent stem cells. Chang CW, Lai YS, Pawlik KM, Liu K, Sun CW, Li C, Schoeb TR, Townes TM. Stem Cells. 2009 May . 27(5):1042-9. 10.1002/stem.39 PubMed 19415770