Plasmid 21627: pKP332 (Lenti-OSK1)
  • hOCT4 - 2A - hSOX2 - 2A - hKLF4

  • POU5F1

  • Porcine teschovirus-1 2A peptide

  • 3589

  • H. sapiens (human); Porcine teschovirus-1

  • BC117435 BC029923 BC013923

  • POU5F1 (DADB-104B20.2, OCT3, OCT4, OTF-3, OTF3, OTF4, Oct-3, Oct-4)

  • pDL171 (pWPI with deletion of 1409 bp XhoI [EMCV IRES GFP] frag)
    (Search Vector Database)

  • Mammalian Expression, Lentiviral, Cre/Lox

  • 9692

  • SwaI

  • No

  • SwaI

  • No

  • GGCACCTCGATTAGTTCTCGAGC List of Sequencing Primers


  • Ampicillin

  • Stbl3

  • 37

  • High Copy

  • View sequences (6)
  • Tim Townes

    Ancillary Agreement for Plasmids Containing FP Materials


Plasmid constructed by Kevin Pawlik

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: Polycistronic lentiviral vector for "hit and run" reprogramming of adult skin fibroblasts to induced pluripotent stem cells. Chang et al (Stem Cells. 2009 May . 27(5):1042-9. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 21627" in your Materials and Methods section.

Price: US $65

Available to academic and non-profits only