1
Plasmid 24593: AAV-pgk-Cre
  • Cre recombinase (codon optimized)

  • Cre recombinase

  • 1056

  • codon optimized cDNA

  • AY056050

  • pAAV-pgk-MCS
    (Search Vector Database)

  • Cre/Lox ; Adeno-associated

  • 4500

  • EcoRI

  • No

  • SalI

  • No

  • TCTTATCTTCCTCCCACAGC List of Sequencing Primers

  • hGH-PA-R

  • Ampicillin

  • DH5alpha

  • 37

  • High Copy

  • View sequences (2)
  • Patrick Aebischer

  • MTA

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 24593" in your Materials and Methods section.

Price: $65.00

Available to academic and non-profits only