1
Plasmid 26098: pCW-LIC
  • SGC Empty backbone for bacterial expression

  • None

  • Three consecutive Taq promoters, 2 active

  • N terminal on backbone

  • pCW-LIC
    (Search Vector Database)

  • Structural Genomics Consortium

  • Bacterial Expression

  • 6980

  • pCW-SEQ-fwd (ACATCGTATAACGTTACTGG) List of Sequencing Primers

  • Ampicillin

  • DH5alpha

  • 37

  • High Copy

  • View sequences (2)
  • View map

  • pCW-LIC (application/pdf)

  • Cheryl Arrowsmith

  • UBMTA

  • Industry MTA

Addgene has sequenced a portion of this plasmid for verification. Full plasmid sequence is available only if provided by the depositing laboratory.

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 26098" in your Materials and Methods section.