1
Plasmid 26098: pCW-LIC
  • SGC Empty backbone for bacterial expression

  • None

  • Three consecutive Taq promoters, 2 active

  • N terminal on backbone

  • pCW-LIC
    (Search Vector Database)

  • Structural Genomics Consortium

  • Bacterial Expression

  • 6980

  • pCW-SEQ-fwd (ACATCGTATAACGTTACTGG) List of Sequencing Primers

  • Ampicillin

  • DH5alpha

  • 37

  • High Copy

  • View sequences (2)
  • View map

  • pCW-LIC (application/pdf)

  • Cheryl Arrowsmith

  • UBMTA

  • Industry MTA

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 26098" in your Materials and Methods section.