1
Plasmid 26279: pGL2-hOct4 DE-SV40-Luc
  • Oct4 Distal Enhancer Element (DE)

  • 2002

  • H. sapiens (human)

  • pGL2-SV40-Luc
    (Search Vector Database)

  • Mammalian Expression

  • 5000

  • XhoI

  • No

  • KpnI

  • No

  • ggtacccattgagtccaaatcct List of Sequencing Primers

  • Ampicillin

  • DH5alpha

  • 37

  • High Copy

  • Backbone kindly provided from Dr. Ron Mckay and Dr. Paul Tesar

  • View sequences (2)
  • Rudolf Jaenisch

  • MTA
    Luciferase Limited Use Label License

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: Human embryonic stem cells with biological and epigenetic characteristics similar to those of mouse ESCs. Hanna et al (Proc Natl Acad Sci U S A. 2010 May 18. 107(20):9222-7. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 26279" in your Materials and Methods section.