Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Addgene is open for ordering and depositing; find up-to-date details here. To learn more about how we are supporting COVID-19 research and to find related plasmids, check out our COVID-19 and Coronavirus Plasmids & Resources page.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pGL2-hOct4 DE-SV40-Luc
(Plasmid #26279)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 26279 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pGL2-SV40-Luc
  • Backbone size w/o insert (bp) 5000
  • Vector type
    Mammalian Expression, Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Oct4 Distal Enhancer Element (DE)
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2002
  • Mutation
    See Depositor Comments below
  • Entrez Gene
    POU5F1 (a.k.a. OCT3, OCT4, OTF-3, OTF3, OTF4, Oct-3, Oct-4)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site KpnI (not destroyed)
  • 5′ sequencing primer ggtacccattgagtccaaatcct
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Backbone kindly provided from Dr. Ron Mckay and Dr. Paul Tesar
  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry

Depositor Comments

Addgene NGS identified multiple sequence variants in the insert sequence, relative to the depositor provided sequence. See the sequences page for additional details.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGL2-hOct4 DE-SV40-Luc was a gift from Rudolf Jaenisch (Addgene plasmid # 26279 ; http://n2t.net/addgene:26279 ; RRID:Addgene_26279)
  • For your References section:

    Human embryonic stem cells with biological and epigenetic characteristics similar to those of mouse ESCs. Hanna J, Cheng AW, Saha K, Kim J, Lengner CJ, Soldner F, Cassady JP, Muffat J, Carey BW, Jaenisch R. Proc Natl Acad Sci U S A. 2010 May 18. 107(20):9222-7. 10.1073/pnas.1004584107 PubMed 20442331