FCbAIGW
(Plasmid #26669)

Available to Academic and Nonprofits Only

Backbone

  • Vector backbone
    FCbAIGW
  • Backbone size (bp) 11067
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    EGFP

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl2
  • Growth instructions
    Stbl2
  • Copy number
    Unknown

Sequence Information

Gene/Insert

  • Gene/Insert name
    None
  • Tag / Fusion Protein
    • IRES-EGFP (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XbaI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer FUGW-Fwd (ATTACAGGGACAGCAGAGATCC)
  • 3′ sequencing primer EGFP-N
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

The vector has neuron specific promoter with downstream IRES2-EGFP sequence which allow the fluorescence marker protein to be expressed in a lower level under the same promoter with the transgene.

How to cite this plasmid

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    FCbAIGW was a gift from Gerardo Morfini (Addgene plasmid # 26669)