FCbAIGW
(Plasmid
#26669)
-
Purpose(Empty Backbone)
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 26669 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneFCbAIGW
- Backbone size (bp) 11067
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersEGFP
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl2
-
Growth instructionsStbl2
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameNone
-
Tag
/ Fusion Protein
- IRES-EGFP (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XbaI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer FUGW-Fwd (ATTACAGGGACAGCAGAGATCC)
- 3′ sequencing primer EGFP-N (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The vector has neuron specific promoter with downstream IRES2-EGFP sequence which allow the fluorescence marker protein to be expressed in a lower level under the same promoter with the transgene.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
FCbAIGW was a gift from Gerardo Morfini (Addgene plasmid # 26669 ; http://n2t.net/addgene:26669 ; RRID:Addgene_26669)