1
Plasmid 26669: FCbAIGW
  • None

  • IRES-EGFP

  • C terminal on backbone

  • FCbAIGW
    (Search Vector Database)

  • Mammalian Expression, Lentiviral

  • 11067

  • XbaI

  • No

  • BamHI

  • No

  • FUGW-Fwd (ATTACAGGGACAGCAGAGATCC) List of Sequencing Primers

  • EGFP-N

  • Ampicillin

  • Stbl2

  • 37

  • Stbl2

  • Unknown

  • EGFP

  • View sequences (3)
  • Gerardo Morfini

  • MTA

Comments: 

The vector has neuron specific promoter with downstream IRES2-EGFP sequence which allow the fluorescence marker protein to be expressed in a lower level under the same promoter with the transgene.

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 26669" in your Materials and Methods section.

Price: US $65

Available to academic and non-profits only