1
Plasmid 26669: FCbAIGW
  • None

  • IRES-EGFP

  • C terminal on backbone

  • FCbAIGW
    (Search Vector Database)

  • Mammalian Expression, Lentiviral

  • 11067

  • XbaI

  • No

  • BamHI

  • No

  • FUGW-Fwd (ATTACAGGGACAGCAGAGATCC) List of Sequencing Primers

  • EGFP-N

  • Ampicillin

  • Stbl2

  • 37

  • Stbl2

  • Unknown

  • EGFP

  • View sequences (3)
  • Gerardo Morfini

  • UBMTA
    Ancillary Agreement for Plasmids Containing FP Materials

Comments: 

The vector has neuron specific promoter with downstream IRES2-EGFP sequence which allow the fluorescence marker protein to be expressed in a lower level under the same promoter with the transgene.

Addgene has sequenced a portion of this plasmid for verification. Full plasmid sequence is available only if provided by the depositing laboratory.

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 26669" in your Materials and Methods section.

Price: US $65

Available to academic and non-profits only