This website uses cookies to ensure you get the best experience. By continuing the use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at Learn more

(Plasmid #26669)


Item Catalog # Description Quantity Price (USD)
Plasmid 26669 Plasmid sent as bacteria in agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size (bp) 11067
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Growth instructions
  • Copy number


  • Gene/Insert name
  • Tag / Fusion Protein
    • IRES-EGFP (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XbaI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer FUGW-Fwd (ATTACAGGGACAGCAGAGATCC)
  • 3′ sequencing primer EGFP-N
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

The vector has neuron specific promoter with downstream IRES2-EGFP sequence which allow the fluorescence marker protein to be expressed in a lower level under the same promoter with the transgene.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    FCbAIGW was a gift from Gerardo Morfini (Addgene plasmid # 26669)