Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pLKO.1-blast-SCRAMBLE
(Plasmid #26701)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 26701 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pLKO.1-blast
  • Backbone manufacturer
    Mostov lab (Addgene Plasmid# 26655)
  • Backbone size w/o insert (bp) 7000
  • Vector type
    Mammalian Expression, Lentiviral, RNAi
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    scramble
  • gRNA/shRNA sequence
    CCTAAGGTTAAGTCGCCCTCG
  • Species
    doesn't match any mammalian sequence

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (destroyed during cloning)
  • 3′ cloning site EcoRI (destroyed during cloning)
  • 5′ sequencing primer LKO.1 5'
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLKO.1-blast-SCRAMBLE was a gift from Keith Mostov (Addgene plasmid # 26701 ; http://n2t.net/addgene:26701 ; RRID:Addgene_26701)
  • For your References section:

    A molecular network for de novo generation of the apical surface and lumen. Bryant DM, Datta A, Rodriguez-Fraticelli AE, Peranen J, Martin-Belmonte F, Mostov KE. Nat Cell Biol. 2010 Oct 3. ():. 10.1038/ncb2106 PubMed 20890297