1
Plasmid 26750: pDREV-0
  • H2B-Venus CDS

  • HIST1H2BB, H2B.1, H2B/f, H2BFF, MGC119804

  • 1101

  • H. sapiens (human)

  • NM_021058

  • HIST1H2BB (H2B.1, H2B/f, H2BFF)

  • Venus

  • C terminal on insert

  • pL1L2_gt0
    (Search Vector Database)

  • B. Rosen and W.C.Skarnes, unpublished

  • Mammalian Expression, Cre/Lox ; FLP/FRT; DRE/Rox

  • 4500

  • BlgII

  • No

  • HindIII

  • No

  • FCHK2 sequence: GTATCTGCAACCTCAAGCTAGC List of Sequencing Primers

  • ClonNAT (nourseothricin)

  • DH5alpha

  • 37

  • High Copy

  • Puromycin

  • PGK-Puro cassette from Addgene plasmid 11349

  • View sequences (3)
  • View map

  • Rolf Zeller

  • MTA

Comments: 

The pDREV plasmid series encode a 5' FRT site and a 3' loxP site for re-engineering of the IKMC knock-out first alleles by dual RMCE (dRMCE) as described in Osterwalder et al. "Dual RMCE for efficient re-engineering of mouse mutant alleles" Nature Methods (2010) DOI 10.1038/nmeth.1521

Protocol for using these plasmids can be found here: http://www.nature.com/protocolexchange/protocol...

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: Dual RMCE for efficient re-engineering of mouse mutant alleles Osterwalder et al (Nat Methods. 2010 Oct 17 PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 26750" in your Materials and Methods section.

Price: $65.00

Available to academic and non-profits only