pLOVE-miR302/367
(Plasmid #31310)

• Depositing Lab: Ed Morrisey
• Publication: Anokye-Danso et al Cell Stem Cell. 2011 Apr 8. 8(4):376-88.

Backbone

• Vector backbone: pLOVE
• Backbone manufacturer: Ramalho-Santos Laboratory
• Backbone size w/o insert (bp): 7263
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: None

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): Stbl3
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: mmu-miR302/367
• Alt name: None
• Species: M. musculus (mouse)
• Insert Size (bp): 690
• Mutation: None

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BsrGI (not destroyed)
• 3′ cloning site: BsrGI (not destroyed)
• 5′ sequencing primer: n/a
• 3′ sequencing primer: ACCGAGGAGAGGGTTAGGGAT

Resource Information

• Supplemental Documents:
  • Culture Conditions for pLOVE propagation
  • Reprogramming Protocol
• A portion of this plasmid was derived from a plasmid made by: Genomic DNA
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

WARNING: This plasmid is highly unstable. You may need to screen several DNA preps to isolate the intact construct.