pTARA
(Plasmid #31491)

• Depositing Lab: Kathleen Matthews
• Publication: Wycuff et al Anal Biochem. 2000 Jan 1. 277(1):67-73.

Backbone

• Vector backbone: pBAD33
• Backbone size w/o insert (bp): 5400
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol, 25 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): GC5
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: RNA polymerase
• Alt name: T7 RNA polymerase
• Species: T7 phage
• Insert Size (bp): 2652
• Mutation: N823D

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Sac1 (not destroyed)
• 3′ cloning site: Xba1 (not destroyed)
• 5′ sequencing primer: ATGCCATAGCATTTTTATCC
• 3′ sequencing primer: GATTTAATCTGTATCAGG

Resource Information

• Supplemental Documents:
  • Additional pTARA information
• A portion of this plasmid was derived from a plasmid made by: pAR1219 encoded T7 polymerase, obtained from Ian Molineux, University of Texas; pBAD33 was obtained from L. Guzman
• Articles Citing this Plasmid:
  • 4 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

For expression: E. coli CV2

N823D mutation should not affect plasmid function.