-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 31491 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepBAD33
- Backbone size w/o insert (bp) 5400
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)GC5
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameRNA polymerase
-
Alt nameT7 RNA polymerase
-
SpeciesT7 phage
-
Insert Size (bp)2652
-
MutationN823D
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Sac1 (not destroyed)
- 3′ cloning site Xba1 (not destroyed)
- 5′ sequencing primer ATGCCATAGCATTTTTATCC
- 3′ sequencing primer GATTTAATCTGTATCAGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made bypAR1219 encoded T7 polymerase, obtained from Ian Molineux, University of Texas; pBAD33 was obtained from L. Guzman
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
For expression: E. coli CV2
N823D mutation should not affect plasmid function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTARA was a gift from Kathleen Matthews (Addgene plasmid # 31491 ; http://n2t.net/addgene:31491 ; RRID:Addgene_31491) -
For your References section:
Generation of an AraC-araBAD promoter-regulated T7 expression system. Wycuff DR, Matthews KS. Anal Biochem. 2000 Jan 1. 277(1):67-73. 10.1006/abio.1999.4385 PubMed 10610690