1
Plasmid 32442: CMV-GEM-GECO1
  • GEM-GECO1

  • emission ratiometric genetically encoded Ca2+-indicators for optical imaging

  • 1248

  • synthetic construct

  • JN258409

  • GCaMP3 L60P/K69E/N77Y/D86G/N98I/K119I/L173Q/T223S/N302S/R377P/K380Q/S404G/E430V

  • Customized Vector
    (Search Vector Database)

  • Mammalian Expression

  • 3200

  • CMV

  • BamHI

  • No

  • EcoRI

  • No

  • TAATACGACTCACTATAGGG List of Sequencing Primers

  • TAGAAGGCACAGTCGAGG

  • Ampicillin

  • DH10B

  • 37

  • High Copy

  • View sequences (3)
  • Robert Campbell

  • MTA

Comments: 

Note: Could not make stable cell line using this vector.

Addgene's sequencing result identified a single nucleotide mismatch at position 1182 when compared to the sequence provided by the depositing scientist and GenBank ID JN258409. According to the depositing scientist, this mismatch does not affect the protein sequence and is not a concern for the function of the plasmid.

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: An Expanded Palette of Genetically Encoded Ca2+ Indicators. Zhao et al (Science. 2011 Sep 8. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 32442" in your Materials and Methods section.

Price: $65.00

Available to academic and non-profits only