1
Plasmid Cart
Login to add to cart
Recently Visited
Plasmid 32447: CMV-G-GECO1.0
  • G-GECO1.0

  • green intensiometric genetically encoded Ca2+-indicators for optical imaging version 1.0

  • 1251

  • JN258413

  • GCaMP3 K119I/L173Q/S404G/E430V

  • Customized Vector
    (Search Vector Database)

  • Mammalian Expression

  • 3200

  • BamHI

  • No

  • EcoRI

  • No

  • TAATACGACTCACTATAGGG List of Sequencing Primers

  • TAGAAGGCACAGTCGAGG

  • Ampicillin

  • DH10B

  • 37

  • High Copy

  • View sequences (3)
  • Robert Campbell

  • MTA

Comments: 

Note: Could not make stable cell line using this vector.

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: An Expanded Palette of Genetically Encoded Ca2+ Indicators. Zhao et al (Science. 2011 Sep 8. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 32447" in your Materials and Methods section.