1
Plasmid 32446: CMV-G-GECO1.2
  • G-GECO1.2

  • green intensiometric genetically encoded Ca2+-indicators for optical imaging version 1.2

  • 1257

  • JN258415

  • GCaMP3 K69E/N77Y/D86G/K119I/L173Q/D260G/S404G/E430V

  • Customized Vector
    (Search Vector Database)

  • Mammalian Expression

  • 3200

  • CMV

  • BamHI

  • No

  • EcoRI

  • No

  • TAATACGACTCACTATAGGG List of Sequencing Primers

  • TAGAAGGCACAGTCGAGG

  • Ampicillin

  • DH10B

  • 37

  • High Copy

  • View sequences (3)
  • Robert Campbell

  • MTA

Comments: 

Note: Could not make stable cell line using this vector.

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: An Expanded Palette of Genetically Encoded Ca2+ Indicators. Zhao et al (Science. 2011 Sep 8. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 32446" in your Materials and Methods section.

Price: $65.00

Available to academic and non-profits only