1
Plasmid 35499: pAAV-CaMKIIa-C1V1 (t/t)-TS-EYFP
  • ChR1-VChR1 Chimera

  • C1V1 (t/t)

  • 1818

  • Synthetic

  • AEL28923.1

  • EYFP

  • C terminal on insert

  • E122T and E162T

  • pAAV
    (Search Vector Database)

  • Mammalian Expression ; AAV

  • 5385

  • Addition of a CaMKIIa promoter and a WPRE

  • CaMKIIa

  • BamHI

  • No

  • EcoRI

  • No

  • AGTCCTGCAGTATTGTGTAT List of Sequencing Primers

  • GCAATAGCATGATACAAAGG

  • Ampicillin

  • Stbl3

  • 37

  • High Copy

  • View sequences (4)
  • View map

  • Karl Deisseroth

  • UBMTA

Comments: 

Addgene has sequenced a portion of this plasmid for verification. Full plasmid sequence is available only if provided by the depositing laboratory.

Article: Neocortical excitation/inhibition balance in information processing and social dysfunction. Yizhar et al (Nature. 2011 Jul 27;477(7363):171-8. doi: 10.1038/nature10360. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 35499" in your Materials and Methods section.