-
PurposeAAV expression of CaMKII-driven chimeric opsin variant C1V1 (E122T/E162T) for fast and potent optical excitation at red-shifted wavelengths.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 35500 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepAAV
- Backbone size w/o insert (bp) 5385
-
Modifications to backboneAddition of a CaMKIIa promoter and a WPRE
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameChR1-VChR1 Chimera
-
Alt nameC1V1 (t/t)
-
SpeciesSynthetic
-
Insert Size (bp)1809
-
MutationE122T and E162T
-
GenBank IDAEL28923.1
- Promoter CaMKIIa
-
Tag
/ Fusion Protein
- mCherry (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer AGTCCTGCAGTATTGTGTAT
- 3′ sequencing primer GCAATAGCATGATACAAAGG (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-CaMKIIa-C1V1 (t/t)-TS-mCherry was a gift from Karl Deisseroth (Addgene plasmid # 35500 ; http://n2t.net/addgene:35500 ; RRID:Addgene_35500) -
For your References section:
Neocortical excitation/inhibition balance in information processing and social dysfunction. Yizhar O, Fenno LE, Prigge M, Schneider F, Davidson TJ, O'Shea DJ, Sohal VS, Goshen I, Finkelstein J, Paz JT, Stehfest K, Fudim R, Ramakrishnan C, Huguenard JR, Hegemann P, Deisseroth K. Nature. 2011 Jul 27;477(7363):171-8. doi: 10.1038/nature10360. 10.1038/nature10360 PubMed 21796121