1
Plasmid 35512: pAAV-CaMKIIa-hChR2(E123T/T159C)-mCherry
  • hChR2

  • 1646

  • Chlamydomonas reinhardtii

  • mCherry

  • C terminal on insert

  • E123T and T159C

  • pAAV
    (Search Vector Database)

  • Mammalian Expression ; AAV

  • 5385

  • Addition of a CaMKIIa promoter and a WPRE

  • CaMKIIa

  • BamHI

  • No

  • EcoRI

  • No

  • AGTCCTGCAGTATTGTGTAT List of Sequencing Primers

  • GCAATAGCATGATACAAAGG

  • Ampicillin

  • Stbl3

  • 37

  • High Copy

  • View sequences (4)
  • View map

  • Karl Deisseroth

  • UBMTA
    Clontech Limited Use Label License

Comments: 

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: Principles for applying optogenetic tools derived from direct comparative analysis of microbial opsins. Mattis et al (Nat Methods. 2011 Dec 18;9(2):159-72. doi: 10.1038/nmeth.1808. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 35512" in your Materials and Methods section.