1
Plasmid 36246: TBRE-TK-Luc-WT
  • Two copies of the Brachyury T-box site

  • Luciferase

  • C terminal on backbone

  • pTK-luc
    (Search Vector Database)

  • Mammalian Expression

  • 6800

  • TK minimal promoter

  • HindIII

  • No

  • BamHI

  • No

  • N/A List of Sequencing Primers

  • Luc_N_Rev

  • Ampicillin

  • DH5alpha

  • 37

  • Unknown

  • View sequences (1)
  • pTK-luc (application/pdf)

  • Bruce Blumberg

  • MTA
    Luciferase Limited Use Label License

Comments: 

Brachyury palindromic element:
AATTTCACACCTAGGTGTGAAATT

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: RIPPLY3 is a retinoic acid-inducible repressor required for setting the borders of the pre-placodal ectoderm. Janesick et al (Development. 2012 Mar;139(6):1213-24. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 36246" in your Materials and Methods section.

Price: $65.00

Available to academic and non-profits only