1
Plasmid 36450: pHAGE hSPC-eGFP-W
  • human SP-C promoter

  • 3813

  • H. sapiens (human)

  • eGFP

  • 719

  • eGFP (pPRS3a_01)

  • pHAGE
    (Search Vector Database)

  • Richard Mulligan

  • Lentiviral

  • 4874

  • human SP-C promoter

  • Not1

  • No

  • BamH1

  • No

  • ACGGACACATATAAGACCCTGGTCACA List of Sequencing Primers

  • GGAGCAACATAGTTAAGAATACCAGTCAATCTTTC

  • N/A

  • Nde1

  • Unknown

  • Not1

  • No

  • CCATTATCGTTTCAGACCCACCTCC List of Sequencing Primers

  • TCGCCGTCGAACTTCACCTCG

  • Ampicillin

  • DH5alpha

  • 37

  • High Copy

  • human 3.7 kb SP-C promoter obtained from Whitsett Lab (Whitsett 3.7SPC/SV40 plasmid).

  • View sequences (3)
  • View map

  • Darrell Kotton

  • MTA

Comments: 

Cloned h3.7kb SP-C promoter (from Whitsett 3.7SPC/SV40 plasmid)
into pHAGE-CMV-GFP-W as follows:

SV40t removed from SPC plasmid by BamH1-BamH1 cutting, blunting and self-ligtion of blunt ends. Entire hSPC promoter lifted out by cutting Nde1-Not1 and ligated into pHAGE CMV-GFP-W backbone pre-cut Nde1-Not1 to remove most of CMV promoter. Cut this backbone Spe1-Nde1 to remove residual CMV promoter fragment, blunted and ligated
NB: final vector still has Spe1 site at start of promoter.

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: Efficient derivation of purified lung and thyroid progenitors from embryonic stem cells. Longmire et al (Cell Stem Cell. 2012 Apr 6;10(4):398-411. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 36450" in your Materials and Methods section.

Price: $65.00

Available to academic and non-profits only