Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Addgene is open for ordering and depositing; find up-to-date details here. To learn more about how we are supporting COVID-19 research and to find related plasmids, check out our COVID-19 and Coronavirus Plasmids & Resources page.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pMSCV-LTR-dCas9-VP64-BFP
(Plasmid #46912)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 46912 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    MSCV-puro
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 6300
  • Total vector size (bp) 11369
  • Vector type
    Mammalian Expression, Retroviral, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    Low Copy

Gene/Insert 1

  • Gene/Insert name
    dCas9-VP64-BFP fusion
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    5055
  • Promoter LTR
  • Tags / Fusion Proteins
    • 3xNLS (C terminal on insert)
    • BFP (C terminal on insert)
    • VP64 domain (C terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer CCCTTGAACCTCCTCGTTCGACC
  • 3′ sequencing primer GAGACGTGCTACTTCCATTTGTC
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    Puromycin resistance
  • Insert Size (bp)
    654
  • Promoter PGK

Cloning Information for Gene/Insert 2

Resource Information

Depositor Comments

The Cas9 contains a N612K mutation that does not effect the function of the enzyme.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMSCV-LTR-dCas9-VP64-BFP was a gift from Stanley Qi & Jonathan Weissman (Addgene plasmid # 46912 ; http://n2t.net/addgene:46912 ; RRID:Addgene_46912)
  • For your References section:

    CRISPR-Mediated Modular RNA-Guided Regulation of Transcription in Eukaryotes. Gilbert LA, Larson MH, Morsut L, Liu Z, Brar GA, Torres SE, Stern-Ginossar N, Brandman O, Whitehead EH, Doudna JA, Lim WA, Weissman JS, Qi LS. Cell. 2013 Jul 9. pii: S0092-8674(13)00826-X. doi: 10.1016/j.cell.2013.06.044. 10.1016/j.cell.2013.06.044 PubMed 23849981