Modified Shipping Schedule: Addgene will be closed November 23rd & 24th for the Thanksgiving holiday. Order processing and shipping may be delayed the week of Nov 20 - 24. If you have any questions, please contact us at [email protected].
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #46913)


Item Catalog # Description Quantity Price (USD)
Plasmid 46913 Plasmid sent as bacteria in agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
  • Backbone size w/o insert (bp) 6300
  • Total vector size (bp) 11987
  • Vector type
    Mammalian Expression, Retroviral, CRISPR
  • Selectable markers

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    Low Copy

Gene/Insert 1

  • Gene/Insert name
    dCas9-p65AD-BFP fusion
  • Species
    H. sapiens (human)
  • Insert Size (bp)
  • Promoter LTR
  • Tags / Fusion Proteins
    • 2xNLS (C terminal on insert)
    • BFP (C terminal on insert)
    • VP64 domain (C terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer CCCTTGAACCTCCTCGTTCGACC
  • 3′ sequencing primer GAGACGTGCTACTTCCATTTGTC
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    Puromycin resistance
  • Insert Size (bp)
  • Promoter PGK

Cloning Information for Gene/Insert 2

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMSCV-LTR-dCas9-p65AD-BFP was a gift from Stanley Qi & Jonathan Weissman (Addgene plasmid # 46913)
  • For your References section:

    CRISPR-Mediated Modular RNA-Guided Regulation of Transcription in Eukaryotes. Gilbert LA, Larson MH, Morsut L, Liu Z, Brar GA, Torres SE, Stern-Ginossar N, Brandman O, Whitehead EH, Doudna JA, Lim WA, Weissman JS, Qi LS. Cell. 2013 Jul 9. pii: S0092-8674(13)00826-X. doi: 10.1016/j.cell.2013.06.044. 10.1016/j.cell.2013.06.044 PubMed 23849981