This website uses cookies to ensure you get the best experience. By continuing the use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #48223)


Item Catalog # Description Quantity Price (USD)
Plasmid 48223 Plasmid sent as bacteria in agar stab 1 $65

This material is available to academics and nonprofits only.


Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number


  • Gene/Insert name
    dCas9(D10A;H840A) fusion with VP64 activation domain
  • Alt name
  • Species
    H. sapiens (human), Synthetic
  • Insert Size (bp)
  • Mutation
    D10A;H840A (catalytically inactive)
  • Promoter CAGGS
  • Tags / Fusion Proteins
    • HA Tag (N terminal on insert)
    • VP64 (C terminal on insert)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer gggcttgtcgagacagagaagat
  • 3′ sequencing primer ACCGAGGAGAGGGTTAGGGAT
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

For more information including protocols and
updates, please go to

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAC91-pmax-dCas9VP64 was a gift from Rudolf Jaenisch (Addgene plasmid # 48223)
  • For your References section:

    Multiplexed activation of endogenous genes by CRISPR-on, an RNA-guided transcriptional activator system. Cheng AW, Wang H, Yang H, Shi L, Katz Y, Theunissen TW, Rangarajan S, Shivalila CS, Dadon DB, Jaenisch R. Cell Res. 2013 Aug 27. doi: 10.1038/cr.2013.122. 10.1038/cr.2013.122 PubMed 23979020