pAC155-pCR8-sgExpression
(Plasmid #49045)

• Purpose: (Empty Backbone) U6-driven sgRNA expressing cassette on a gateway donor vector
• Depositing Lab: Rudolf Jaenisch
• Publication: Cheng et al Cell Res. 2013 Aug 27. doi: 10.1038/cr.2013.122.

Backbone

• Vector backbone: pCR8GWTOPO
• Backbone manufacturer: Invitrogen
• Backbone size (bp): 2734
• Modifications to backbone: rrnBT1 was truncated to remove a BbsI site that is used for cloning of sgRNA
• Vector type: Mammalian Expression, CRISPR
• Promoter: U6

Growth in Bacteria

• Bacterial Resistance(s): Spectinomycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Cloning Information

• 5′ sequencing primer: M13F
• 3′ sequencing primer: M13R

Resource Information

• A portion of this plasmid was derived from a plasmid made by: The U6-sgRNA-temrinator expression cassette was PCR amplifed from pX335
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Clone sgRNA spacer into BbsI site. Sequence using LKO5' primer: GACTATCATATGCTTACCGT

This vector can be transfected, or transferred to a gateway destination vector ( http://www.lifetechnologies.com/us/en/home/life-science/cloning/gateway-cloning/gateway-destination-vectors.html ), or the U6-sgRNA-terminator fragment can be PCR-amplified and transfected as linear DNA. Another template for such linear DNA is one of the dual expression vectors:

http://www.addgene.org/48240/
http://www.addgene.org/48239/
http://www.addgene.org/48238/
http://www.addgene.org/48236/

For more information including protocols and
updates, please go to http://www.crispr-on.org