Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pAAV-CaMKIIa-oChIEF(E163A/T199C)-P2A-EGFP
(Plasmid #51093)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 51093 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pAAV-CaMKIIa-WPRE-HGHpA
  • Backbone manufacturer
    custom
  • Backbone size w/o insert (bp) 5100
  • Total vector size (bp) 7253
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    oChIEF(E163A/T199C)
  • Alt name
    oChIEFac
  • Species
    Synthetic
  • Insert Size (bp)
    1085
  • Mutation
    E163A/T199C
  • Promoter CaMKIIa
  • Tag / Fusion Protein
    • P2A-EGFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site HpaI (not destroyed)
  • 5′ sequencing primer aggagcacgggcaggcgagtgg
  • 3′ sequencing primer CCATACGGGAAGCAATAGCATG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    The original oChIEF portion was obtained from John Lin and Roger Tsien (UCSD/HHMI)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The addition of the E163A and T199C mutations in oChIEF impart higher photocurrent amplitude while retaining fast kinetic properties. This variant is proposed as an alternative to ChETA variants that exhibit smaller photocurrents and more toxicity.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-CaMKIIa-oChIEF(E163A/T199C)-P2A-EGFP was a gift from Jonathan Ting (Addgene plasmid # 51093 ; http://n2t.net/addgene:51093 ; RRID:Addgene_51093)