-
PurposeForebrain principal neuron expression of eArchT3,0 with physically uncoupled EGFP fluorophore
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 51110 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepAAV-CaMKIIa-WPRE-HGHpA
-
Backbone manufacturerKarl Deisseroth
- Backbone size w/o insert (bp) 6064
- Total vector size (bp) 7034
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameeArchT3.0
-
Alt nameArchT-TS-ERexport
-
SpeciesHalorubrum sp. TP009
-
Insert Size (bp)970
- Promoter CaMKIIa
-
Tag
/ Fusion Protein
- P2A-EGFP (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site HpaI (not destroyed)
- 5′ sequencing primer aggagcacgggcaggcgagtgg
- 3′ sequencing primer CCATACGGGAAGCAATAGCATG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byArchT was obtained from Ed Boyden and was used with permission. TS and ER export motif were added by PCR to make eArchT3.0
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This is a cell filling variant for expression of eArchT3.0 and cytosolic EGFP.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-CaMKIIa-eArchT3.0-P2A-EGFP-WPRE-hGHpA was a gift from Jonathan Ting (Addgene plasmid # 51110 ; http://n2t.net/addgene:51110 ; RRID:Addgene_51110)