pAAV-CaMKIIa-eArchT3.0-P2A-EGFP-WPRE-hGHpA
(Plasmid #51110)

• Purpose: Forebrain principal neuron expression of eArchT3,0 with physically uncoupled EGFP fluorophore
• Depositing Lab: Jonathan Ting
• Publication: Ting AAV neural silencing tools (unpublished)

Backbone

• Vector backbone: pAAV-CaMKIIa-WPRE-HGHpA
• Backbone manufacturer: Karl Deisseroth
• Backbone size w/o insert (bp): 6064
• Total vector size (bp): 7034
• Vector type: Mammalian Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: eArchT3.0
• Alt name: ArchT-TS-ERexport
• Species: Halorubrum sp. TP009
• Insert Size (bp): 970
• Promoter: CaMKIIa
• Tag / Fusion Protein:
  • P2A-EGFP (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (not destroyed)
• 3′ cloning site: HpaI (not destroyed)
• 5′ sequencing primer: aggagcacgggcaggcgagtgg
• 3′ sequencing primer: CCATACGGGAAGCAATAGCATG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: ArchT was obtained from Ed Boyden and was used with permission. TS and ER export motif were added by PCR to make eArchT3.0

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This is a cell filling variant for expression of eArchT3.0 and cytosolic EGFP.