Skip to main content

AAV-Y-GECO1
(Plasmid #55767)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 55767 Standard format: Plasmid sent in bacteria as agar stab 1 $89

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    pAAV
  • Backbone size w/o insert (bp) 4563
  • Total vector size (bp) 5931
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Y-GECO1.0
  • Alt name
    A yellow fluorescent calcium ion indicator with inverted fluorescent response
  • Species
    Synthetic
  • Insert Size (bp)
    1368
  • GenBank ID
    KJ193859
  • Promoter hSyn

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer GAG GAG TCG TGT CGT GCC
  • 3′ sequencing primer CATAGCGTAAAAGGAGCAACA
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAV-Y-GECO1 was a gift from Robert Campbell (Addgene plasmid # 55767 ; http://n2t.net/addgene:55767 ; RRID:Addgene_55767)
  • For your References section:

    Microfluidic cell sorter-aided directed evolution of a protein-based calcium ion indicator with an inverted fluorescent response. Zhao Y, Abdelfattah AS, Zhao Y, Ruangkittisakul A, Ballanyi K, Campbell RE, Harrison DJ. Integr Biol (Camb). 2014 May 19. 10.1039/c4ib00039k PubMed 24840546