Modified Shipping Schedule: Addgene will be closed November 23rd & 24th for the Thanksgiving holiday. Order processing and shipping may be delayed the week of Nov 20 - 24. If you have any questions, please contact us at [email protected].
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #61254)


Item Catalog # Description Quantity Price (USD)
Plasmid 61254 Plasmid sent as bacteria in agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
    pCR-Blunt II-TOPO
  • Backbone manufacturer
  • Backbone size w/o insert (bp) 3519
  • Total vector size (bp) 4162
  • Vector type
    CRISPR ; Cloning template

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
    sgRNA(F+E) targeting Y61A9L9.1
  • Species
  • Insert Size (bp)
  • GenBank ID

Cloning Information

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    U6 promoter was subcloned from pDD162 (AddGene plasmid #47549) and provided by the Goldstein lab.
  • Terms and Licenses

Depositor Comments

target sequence: gaacgaggctgaaaccctga

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJW1311 was a gift from Jordan Ward (Addgene plasmid # 61254)
  • For your References section:

    Rapid and Precise Engineering of the Caenorhabditis elegans Genome with Lethal Mutation Co-conversion and Inactivation of NHEJ Repair. Ward JD. Genetics. 2014 Dec 9. pii: genetics.114.172361. 10.1534/genetics.114.172361 PubMed 25491644